template<semialphabet alphabet_t, text_layout text_layout_mode_, detail::sdsl_index sdsl_index_type_ = default_sdsl_index_type>
class seqan3::fm_index< alphabet_t, text_layout_mode_, sdsl_index_type_ >
The SeqAn FM Index.
- Template Parameters
-
| alphabet_t | The alphabet type; must model seqan3::semialphabet. |
| text_layout_mode_ | Indicates whether this index works on a text collection or a single text. See seqan3::text_layout. |
| sdsl_index_type_ | The type of the underlying SDSL index, must model seqan3::sdsl_index. |
The seqan3::fm_index is a fast and space-efficient string index to search strings and collections of strings.
General information
Here is a short example on how to build an index and search a pattern using an cursor. Please note that there is a very powerful search module with a high-level interface seqan3::search that encapsulates the use of cursors.
int main()
{
auto cur = index.cursor();
for (auto && pos : cur.locate())
return 0;
}
bool extend_right() noexcept
Tries to extend the query by the smallest possible character to the right such that the query is foun...
Definition: fm_index_cursor.hpp:260
The SeqAn FM Index.
Definition: fm_index.hpp:189
Provides seqan3::debug_stream and related types.
Provides seqan3::dna4, container aliases and string literals.
debug_stream_type debug_stream
A global instance of seqan3::debug_stream_type.
Definition: debug_stream.hpp:37
The SeqAn namespace for literals.
Meta-header for the Search / FM Index submodule .
- Attention
- When building an index for a single text over any alphabet, the symbol with rank 255 is reserved and may not occur in the text.
Here is an example using a collection of strings (e.g. a genome with multiple chromosomes or a protein database):
int main()
{
"TAGCTGAAGCCATTGGCATCTGATCGGACT"_dna4,
"ACTGAGCTCGTC"_dna4,
"TGCATGCACCCATCGACTGACTG"_dna4,
"GTACGTACGTTACG"_dna4};
auto cur = index.cursor();
for (auto && pos : cur.locate())
return 0;
}
- Attention
- When building an index for a text collection over any alphabet, the symbols with rank 254 and 255 are reserved and may not be used in the text.