Using genetic codes
^^^^^^^^^^^^^^^^^^^

Selecting codes in methods that support them
""""""""""""""""""""""""""""""""""""""""""""

In cases where a ``cogent3`` object method has a ``gc`` argument, you can just use the number under "Code ID" column.

For example, I've created a partial codon in ``"s1"``

.. jupyter-execute::

    from cogent3 import make_aligned_seqs

    data = {
        "s1": "GCTCATGCCAGCTCTTTACAGCATGAGAACA--AGT",
        "s2": "ACTCATGCCAACTCATTACAGCATGAGAACAGCAGT",
        "s3": "ACTCATGCCAGCTCATTACAGCATGAGAACAGCAGT",
        "s4": "ACTCATGCCAGCTCATTACAGCATGAGAACAGCAGT",
        "s5": "ACTCATGCCAGCTCAGTACAGCATGAGAACAGCAGT",
    }

    nt_seqs = make_aligned_seqs(data=data, moltype="dna")
    nt_seqs

We specify the genetic code, and we allow incomplete codons. In this case, if a codon contains a gap, they are converted to ``?`` in the translation.

.. jupyter-execute::

    nt_seqs.get_translation(gc=1, incomplete_ok=True)


Translate DNA sequences
"""""""""""""""""""""""

.. jupyter-execute::

    from cogent3 import get_code

    standard_code = get_code(1)
    standard_code.translate("TTTGCAAAC")

Conversion to a ``ProteinSequence`` from a ``DnaSequence`` is shown in :ref:`translation`.

Translate all six frames
""""""""""""""""""""""""

.. jupyter-execute::

    from cogent3 import get_code, make_seq

    standard_code = get_code(1)
    seq = make_seq("ATGCTAACATAAA", moltype="dna")
    translations = standard_code.sixframes(seq)
    print(translations)

Find out how many stops in a frame
""""""""""""""""""""""""""""""""""

.. jupyter-execute::

    from cogent3 import get_code, make_seq

    standard_code = get_code(1)
    seq = make_seq("ATGCTAACATAAA", moltype="dna")
    stops_frame1 = standard_code.get_stop_indices(seq, start=0)
    stops_frame1

.. jupyter-execute::

    stop_index = stops_frame1[0]
    seq[stop_index : stop_index + 3]

Translate a codon
"""""""""""""""""

.. jupyter-execute::

    from cogent3 import get_code, make_seq

    standard_code = get_code(1)
    standard_code["TTT"]

or get the codons for a single amino acid

.. jupyter-execute::

    standard_code["A"]

Look up the amino acid corresponding to a single codon
""""""""""""""""""""""""""""""""""""""""""""""""""""""

.. jupyter-execute::

    from cogent3 import get_code

    standard_code = get_code(1)
    standard_code["TTT"]

Get all the codons for one amino acid
"""""""""""""""""""""""""""""""""""""

.. jupyter-execute::

    from cogent3 import get_code

    standard_code = get_code(1)
    standard_code["A"]

Get all the codons for a group of amino acids
"""""""""""""""""""""""""""""""""""""""""""""

.. jupyter-execute::

    targets = ["A", "C"]
    codons = [standard_code[aa] for aa in targets]
    codons

.. jupyter-execute::

    flat_list = sum(codons, [])
    flat_list

Converting the ``CodonAlphabet`` to codon series
""""""""""""""""""""""""""""""""""""""""""""""""

.. jupyter-execute::

    from cogent3 import get_code

    gc = get_code(1)
    alphabet = gc.get_alphabet()
    print(alphabet)

Obtaining the codons from a ``DnaSequence`` object
""""""""""""""""""""""""""""""""""""""""""""""""""

Use the method ``get_in_motif_size``

.. jupyter-execute::

    from cogent3 import make_seq

    my_seq = make_seq("ATGCACTGGTAA", name="my_gene", moltype="dna")
    codons = my_seq.get_in_motif_size(3)
    codons

Translating a DNA sequence
""""""""""""""""""""""""""

The defaults for ``get_translation()`` include using the standard genetic code and trimming a terminating stop if it exists.

.. jupyter-execute::

    pep = my_seq.get_translation()
    pep

Translating a DNA sequence containing stop codons
"""""""""""""""""""""""""""""""""""""""""""""""""

.. jupyter-execute::
    :hide-code:

    from cogent3.core.alphabet import AlphabetError

Making a sequence that contains both internal and terminating stop codons.

.. jupyter-execute::
    :raises:

    from cogent3 import make_seq

    seq = make_seq("ATGTGATGGTAA", name="s1", moltype="dna")

Translating this will fail with default settings.

.. jupyter-execute::
    :raises: AlphabetError

    pep = seq.get_translation()

Unless you explicitly allow stop codons

.. jupyter-execute::

    pep = seq.get_translation(include_stop=True)
    pep

